After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Ferret PRMT6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRMT6cDNA Clone Product Information
Gene_bank_ref_id:XM_004777503.1
cDNA Size:1128
cDNA Description:ORF Clone of Mustela putorius furo (sub-species: furo) protein arginine methyltransferase 6 DNA.
Gene Synonym:PRMT6
Species:Ferret
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Protein arginine N-methyltransferase 6, also known as Histone-arginine N-methyltransferase PRMT6, PRMT6, and HRMT1L6, is a member of the protein arginine N-methyltransferase family and PRMT6 subfamily. PRMT6 is highly expressed in kidney and testes. PRMT6 is known to catalyze the generation of asymmetric dimethylarginine in polypeptides. It has been implicated in human immunodeficiency virus pathogenesis, DNA repair, and transcriptional regulation. PRMT6 is known to methylate histone H3 Arg-2 (H3R2), and this negatively regulates the lysine methylation of H3K4 resulting in gene repression. PRMT6 plays a key role in coupling process by functioning as a transcriptional coactivator that can regulate alternative splicing. PRMT6 coactivates the progesterone, glucocorticoid and oestrogen receptors in luciferase reporter assays in a hormone-dependent manner. Small interfering RNA (siRNA) oligonucleotide duplex knockdown of PRMT6 disrupts oestrogen-stimulated transcription of endogenous GREB1 and progesterone receptor in MCF-7 breast cancer cells. Neutralizing the activity of PRMT6 could inhibit tumor progression and may be of cancer therapeutic significance.

References
  • Hyllus D, et al., 2007, Genes Dev. 21(24): 3369-80.
  • Lakowski, TM. et al., 2008, J Biol Chem. 283 (15): 10015-25. 
  • Michaud-Levesque, J. et al., 2009, J Biol Chem. 284 (32): 21338-46.
  • Harrison, MJ. et al., 2010, Nucleic acids Res. Jan 4.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"