After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Ferret TREM1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Ferret TREM1 cDNA Clone Product Information
Gene_bank_ref_id:XM_004739942.1
RefSeq ORF Size:615bp
cDNA Description:Full length Clone DNA of Mustela putorius furo (sub-species: furo) triggering receptor expressed on myeloid cells 1.
Gene Synonym:TREM1
Species:Ferret
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

TREM1 (triggering receptor expressed on myeloid cells) is a type I  transmembrane protein with a single Ig-like domain, and is selectively expressed on blood neutrophils and a subset of monocytes. As a member of the growing family of receptors related to NK cell receptors, TREM1 activates downstream signaling events with the help of an adapter protein called DAP12. Expression of TREM1 is up-regulated by bacterial LPS, a ligand for TLR4, as well as lipoteichoic acid. Although its natural ligand has not been identified, engagement of TREM1 with agonist mAbs triggers secretion of the proinflammatory cytokines TNF-α and IL-1β, as well as chemokines such as IL-8 and monocyte chemoattractant protein (MCP)-1. Intracellularly, TREM1 induces Ca2+ mobilization and tyrosine phosphorylation of extracellular signal-related kinase 1 (ERK1), ERK2 and phospholipase C-γ. In an animal model of LPS-induced septic shock, blockade of TREM1 signaling inhibited hyperresponsiveness and death. Thus, it has been demonstrated that TREM1 performs a critical function in immune responses involved in host defense against microbial challenges, and is suggested to be a potential therapeutic target for septic shock.

References
  • Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.
  • Bouchon, A. et al., 2001, Nature. 410: 1103-1107.
  • Bleharski, J.R. et al., 2003, J. Immunol. 170: 3812-3818.
  • Size / Price
    Catalog: FG60048-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"