After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

E.Coli FABI natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
E. coli FABI cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:789bp
cDNA Description:Full length Clone DNA of Escherichia coli enoyl-[acyl-carrier-protein] reductase, NADH-dependent.
Gene Synonym:envM
Species:E. coli
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Enoyl-ACP reductase, also known as NADH-dependent enoyl-ACP reductase and FABI, is a cell inner membrane and peripheral membrane protein which belongs to the short-chain dehydrogenases/reductases (SDR) family and FabI subfamily. Microorganisms produce many kinds of antibiotics which function in an antagonistic capacity in nature where they have much competition. Bacterial FAS provides essential fatty acids for use in the assembly of key cellular components. Among them, FABI is an enoyl-ACP reductase which catalyzes the final and rate-limiting step of bacterial FAS. The antibiotic diazaborine interferes with the activity by binding to the protein. FABI is a potential target for selective antibacterial action, because it shows low overall sequence homology with mammalian enzymes. Various compounds have been reported as inhibitors of bacterial FabI-inhibitory compounds.

References
  • Miller, WH. et al., 2002, J Med Chem  45 (15):3246-56. 
  • Kitagawa, H. et al., 2007, Bioorg Med Chem  15 (2):1106-16.
  • Zheng, C.J. et al., 2007, Biochem Biophys Res Commun 362 (4):1107-12.
  • Lu,H. et al., 2008, Acc Chem Res 41 (1):11-20.
  • Zheng,CJ. et al., 2009, J Antimicrob Chemother 63 (5):949-53.
  • Size / Price
    Catalog: EG30001-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"