After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Canine TPPP3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TPPP3cDNA Clone Product Information
Gene_bank_ref_id:XM_005620833.1
cDNA Size:531
cDNA Description:ORF Clone of Canis lupus familiaris tubulin polymerization-promoting protein family member 3 DNA.
Gene Synonym:TPPP3
Species:Canine
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

TPPP3, a member of the Tubulin polymerization-promoting protein family, is an intrinsically unstructured protein that induces tubulin polymerization. TPPP3 is a marker in the developing musculoskeletal system. In tendons, Tppp3 is expressed in cells at the circumference of the developing tendons, likely the progenitors of connective tissues that surround tendons: the tendon sheath, epitenon, and paratenon. Tppp3 is also expressed in forming synovial joints. The onset of Tppp3 expression in joints coincides with cavitation, representing a molecular marker that can be used to indicate this stage in joint transition in joint differentiation. In late embryonic stages, Tppp3 expression highlights other demarcation lines that surround differentiating tissues in the forelimb.

Depletion of TPPP3 by microRNA-based RNA interference (RNAi) inhibits cell growth, arrests cell cycles, and causes mitotic abnormalities in HeLa cells. C57BL/6 mice that received subcutaneously injected LLC (Lewis lung carcinoma) cells in which TPPP3 was knocked down showed a pronounced reduction in tumor progression. The migration/invasion activity of TPPP3-knockdown LLC cells was significantly suppressed in a transwell chamber migration assay. When these cells were injected into the tail veins of C57BL/6 mice, they exhibited milder lung metastasis compared with control tumor cells. Taken together, these findings suggested that the TPPP3 gene played an important role in tumorigenesis and metastasis, and it could potentially become a novel target for cancer therapy.

References
  • Staverosky JA, et al. (2009) Tubulin polymerization-promoting protein family member 3, Tppp3, is a specific marker of the differentiating tendon sheath and synovial joints. Dev Dyn. 238(3):685-92.
  • Zhou W, et al. (2010) Stable knockdown of TPPP3 by RNA interference in Lewis lung carcinoma cell inhibits tumor growth and metastasis. Mol Cell Biochem. 343(1-2):231-8.
  • Size / Price
    Catalog:DG70233-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"