After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Canine GM2A natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Canine GM2A cDNA Clone Product Information
NCBI RefSeq:XM_003639011.2
RefSeq ORF Size:591bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris GM2 ganglioside activator.
Gene Synonym:GM2A
Species:Canine
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

GM2A (GM2 ganglioside activator), is a lipid transfer protein which belongs to the ML domain family. GM2A can accommodate several single chain phospholipids and fatty acids. It also exhibits some calcium-independent phospholipase activity. GM2A binds gangliosides and stimulates ganglioside GM2 degradation. It stimulates only the breakdown of ganglioside GM2 and glycolipid GA2 by beta-hexosaminidase A. GM2A acts as a substrate specific co-factor for the lysosomal enzyme β-hexosaminidase A. β-hexosaminidase A, together with GM2 ganglioside activator, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. It extracts single GM2 molecules from membranes and presents them in soluble form to beta-hexosaminidase A for cleavage of N-acetyl-D-galactosamine and conversion to GM3. Defects in GM2A are the cause of GM2-gangliosidosis type AB (GM2GAB), also known as Tay-Sachs disease AB variant.

References
  • Wright CS, et al. (2003) Structural analysis of lipid complexes of GM2-activator protein. J Mol Biol. 331(4):951-64.
  • Size / Price
    Catalog: DG70177-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"