After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Canine HGF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HGFcDNA Clone Product Information
Gene_bank_ref_id:NM_001002964.1
cDNA Size:2193
cDNA Description:ORF Clone of Canis lupus familiaris hepatocyte growth factor (hepapoietin A; scatter factor) DNA.
Gene Synonym:HGF
Species:Canine
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Hepatocyte growth factor, also known as HGF, contains 4 kringle domains, 1 PAN domain and 1 peptidase S1 domain. It belongs to the peptidase S1 family, plasminogen subfamily. Hepatocyte growth factor is secreted by mesenchymal cellsas a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule. Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-Met receptor, and acts as a multi-functional cytokine on cells of mainly epithelial origin. Its ability to stimulate mitogenesis, cell motility, and matrix invasion gives it a central role in angiogenesis, tumorogenesis, and tissue regeneration. HGF is a potent mitogen for mature parenchymal hepatocyte cells, seems to be an hepatotrophic factor, and acts as growth factor for a broad spectrum of tissues and cell types. HGF has no detectable protease activity. Defects in hepatocyte growth factor are the cause of deafness autosomal recessive type 39. A form of profound prelingual sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

References
  • Naldini L, et al. (1991) Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET receptor. EMBO J. 10(10):2867-78.
  • Comoglio, et al. (1993) Structure, biosynthesis and biochemical properties of the HGF receptor in normal and malignant cells. 65:131-65.
  • Hahn W, et al. (2011) Enhanced cardioprotective effects by coexpression of two isoforms of hepatocyte growth factor from naked plasmid DNA in a rat ischemic heart disease model. The Journal of Gene Medicine. 13(10):549-55.
  • Bottaro DP, et al. (1991) Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science. 251(4995):802-4.
  • Size / Price
    Catalog:DG70063-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"