After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Canine IL21 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL21cDNA Clone Product Information
cDNA Size:441
cDNA Description:ORF Clone of Canis lupus familiaris interleukin 21 DNA.
Gene Synonym:IL-21, IL21
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Other Interleukin & Receptor Related Products
Product nameProduct name
Mouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Human IL-15 / IL15 / Interleukin 15 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, Fc Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL2Ra / CD25 Protein (Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13 / ALRH Protein (Fc Tag)Human IL13 / ALRH ProteinHuman IL5Ra / CD125 Protein (His Tag)Human IL4R / CD124 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human IL3RA / CD123 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, His Tag)Human IL2RG / CD132 Protein (Fc Tag)Human IL2RG / CD132 Protein (His Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinHuman IL13RA1 Protein (His & Fc Tag)Human IL13RA1 Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Cynomolgus IL13 / ALRH ProteinHuman Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-9 / Interleukin-9 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman Interleukin-2 / IL-2 ProteinHuman IL-3 / Interleukin-3 Protein (His Tag)Mouse IL-4R / CD124 Protein (ECD, His Tag)Mouse IL4 / Interleukin-4 ProteinMouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL2RG Protein (His & Fc Tag)Mouse IL2RG / CD132 Protein (His Tag)Mouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Mouse IL13 / ALRH ProteinMouse IL2RA / CD25 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinMouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Mouse IL5Ra / CD125 Protein (His Tag)Canine IL-8 / CXCL8 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Canine IL5 Protein (His Tag)Canine IL4 / Interleukin-4 ProteinCanine IL13RA2 / IL13R Protein (His Tag)Human IL5 / Interleukin 5 ProteinRat Interleukin-2 / IL-2 ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL7R / IL7RA Protein (His Tag)Rat IL13RA1 Protein (Fc Tag) Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL4R / Il4ra Protein (His Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Cynomolgus IL2RA Protein (His Tag)Cynomolgus IL2RA ProteinCynomolgus IL-8 / CXCL8 ProteinMouse IL16 / Interleukin-16 Protein (His Tag)Canine IL13RA2 / IL13R Protein (Fc Tag)

IL21 belongs to the IL-15/IL-21 family. It is a cytokine with immunoregulatory activity. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. IL21 is expressed in activated CD4-positive T-cells but not in CD8-positive T-cells, B-cells, or monocytes. It may promote the transition between innate and adaptive immunity. IL-21 has been tried as therapy for alleviating allergic responses. It can significantly decrease pro-inflammatory cytokines produced by T cells in addition to decreasing IgE levels in a mouse model for rhinitis (nasal passage inflammation)

  • Coquet JM, et al. (2007) IL-21 is produced by NKT cells and modulates NKT cell activation and cytokine production. J Immunol. 178(5):2827-34.
  • Wei L, et al. (2007) IL-21 is produced by Th17 cells and drives IL-17 production in a STAT3-dependent manner. J Biol Chem. 282(48):34605-10.
  • Parrish-Novak J, et al. (2002) Interleukin-21 and the IL-21 receptor: novel effectors of NK and T cell responses. J Leukoc Biol. 72(5):856-63. 4 Kuchen S, et al. (2007) Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J Immunol. 179(9):5886-96.