After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EEF1B2cDNA Clone Product Information
cDNA Size:678
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) eukaryotic translation elongation factor 1 beta 2 DNA.
Gene Synonym:EEF1B2
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90457-ACG$325
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90457-ACR$325
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90457-ANG$325
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90457-ANR$325
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90457-CF$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90457-CH$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90457-CM$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90457-CY$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone)CG90457-G$95
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90457-NF$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90457-NH$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90457-NM$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90457-NY$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90457-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items