After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ECH1cDNA Clone Product Information
cDNA Size:963
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) enoyl CoA hydratase 1, peroxisomal DNA.
Gene Synonym:ECH1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90439-ACG$325
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90439-ACR$325
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90439-ANG$325
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90439-ANR$325
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90439-CF$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90439-CH$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90439-CM$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90439-CY$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone)CG90439-G$95
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90439-NF$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90439-NH$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90439-NM$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90439-NY$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90439-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

ECH1 is a member of the hydratase/isomerase superfamily. ECH1 shows high sequence similarity to enoyl-CoA hydratases of several species, particularly within a conserved domain characteristic of these proteins. ECH1 contains a C-terminal peroxisomal targeting sequence and localizes to peroxisomes. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans, 5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. ECH1 functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators.

  • Kovalyov LI, et al. (2006) Polymorphism of delta3,5-delta2,4-dienoyl-coenzyme A isomerase (the ECH1 gene product protein) in human striated muscle tissue. Biochemistry Mosc. 71(4): 448-53.
  • Olsen JV, et al. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell. 127(3):635-48.
  • FitzPatrick DR, et al. (1995) Isolation and characterization of rat and human cDNAs encoding a novel putative peroxisomal enoyl-CoA hydratase. Genomics. 27(3):457-66.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items