Quick Order

Text Size:AAA

Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HSP90AA1cDNA Clone Product Information
cDNA Size:2202
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) heat shock protein 90kDa alpha (cytosolic), class A member 1 DNA.
Gene Synonym:HSP90AA1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90401-ACG$345
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90401-ACR$345
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90401-ANG$345
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90401-ANR$345
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90401-CF$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90401-CH$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90401-CM$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90401-CY$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone)CG90401-G$195
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90401-NF$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90401-NH$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90401-NM$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90401-NY$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90401-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Heat shock protein 90 (90 kDa heat-shock protein, HSP90) is a molecular chaperone involved in the trafficking of proteins in the cell. It is a remarkably versatile protein involved in the stress response and in normal homoeostatic control mechanisms. HSP90 interacts with 'client proteins', including protein kinases, transcription factors and others, and either facilitates their stabilization and activation or directs them for proteasomal degradation. By this means, HSP90 displays a multifaceted ability to influence signal transduction, chromatin remodelling and epigenetic regulation, development and morphological evolution. HSP90 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis at the N-terminus. Disruption of HSP90 leads to client protein degradation and often cell death. Under stressful conditions, HSP90 stabilizes its client proteins and provides protection to the cell against cellular stressors such as in cancer cells. Especially, several oncoproteins act as HSP90 client proteins and tumor cells require higher HSP90 activity than normal cells to maintain their malignancy. For this reason, Hsp90 has emerged as a promising target for anti-cancer drug development.

  • Pearl LH, et al. (2008) The Hsp90 molecular chaperone: an open and shut case for treatment. Biochem J. 410(3): 439-53.
  • Hahn JS. (2009) The Hsp90 chaperone machinery: from structure to drug development. BMB Rep. 42(10): 623-30.
  • Holzbeierlein JM, et al. (2010) Hsp90: a drug target? Curr Oncol Rep. 12(2): 95-101.
  • Trepel J, et al. (2010) Targeting the dynamic HSP90 complex in cancer. Nat Rev Cancer. 10(8): 537-49.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items