After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ATF4cDNA Clone Product Information
Gene_bank_ref_id:XM_005567221.1
cDNA Size:1056
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) activating transcription factor 4 DNA.
Gene Synonym:ATF4
Species:Cynomolgus
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90357-ACG$325
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90357-ACR$325
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90357-ANG$325
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90357-ANR$325
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90357-CF$295
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90357-CH$295
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90357-CM$295
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90357-CY$295
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone)CG90357-G$95
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90357-NF$295
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90357-NH$295
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90357-NM$295
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90357-NY$295
Cynomolgus monkey ATF4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90357-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:CG90357-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"