Quick Order

Cynomolgus monkey PCNA natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus PCNA cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:786bp
cDNA Description:Full length Clone DNA of Macaca mulatta proliferating cell nuclear antigen.
Gene Synonym:PCNA
Species:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Proliferating Cell Nuclear Antigen (PCNA) is a protein only expresse in nomal proliferate cells and cancer cells. It is central to both DNA replication and repair. One of the well-established functions for PCNA is its role as the processivity factor for DNA polymerase delta and epsilon. PCNA tethers the polymerase catalytic unit to the DNA template for rapid and processive DNA synthesis. Two forms of PCNA exist in cells: (i) a detergent-insoluble trimeric form stably associated with the replicating forks during S phase and (ii) a soluble form in quiescent cells in G1 and G2 phases. PCNA forms a toroidal trimer in S phase with replication factor-C (RF-C) and DNA in an ATP-dependent manner and enables the loading of DNA polymerase delta and epsilon onto the complex. The close association of PCNA with kinase complexes involved in cell cycle machinery indicates that PCNA has a regulatory role in cell cycle progression. PCNA also participates in the processing of branched intermediates that arise during the lagging strand DNA synthesis.

References
  • Balajee AS, et al. (2001) Chromatin-bound PCNA complex formation triggered by DNA damage occurs independent of the ATM gene product in human cells. Nucleic Acids Res. 29 (6): 1341-51.
  • Ducoux M, et al. (2001) Mediation of proliferating cell nuclear antigen (PCNA)-dependent DNA replication through a conserved p21(Cip1)-like PCNA-binding motif present in the third subunit of human DNA polymerase delta. J Biol Chem. 276 (52): 49258-66.
  • Tetsuo I, et al. (2002) PCNA clamp facilitates action of DNA cytosine methyltransferase 1 on hemimethylated DNA. Genes Cells. 7(10): 997-1007.
  • Size / Price
    Catalog: CG90344-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"