Quick Order

Cynomolgus monkey IL1R1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL1R1cDNA Clone Product Information
cDNA Size:1710
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) interleukin 1 receptor, type I DNA.
Gene Synonym:IL1R1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
IL-1 Family & Receptor Related Products
Product nameProduct name
Canine IL1R2 / IL1RB Protein (Fc Tag)Rat IL18R1 Protein (His Tag)Mouse IL36G / IL1F9 Protein (His Tag)Cynomolgus IL18R1 Protein (Fc Tag)Rabbit IL-1 beta / IL1B ProteinHuman p38 alpha / MAPK14 Protein (Activated in vitro, His Tag)Human IL18 / IL-18 ProteinCanine IL18R1 Protein (ECD, His Tag)Human IL1RL2 / IL-1Rrp2 Protein (Fc Tag)Cynomolgus IL18R1 Protein (His Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL1RL1 / DER4 Protein (Fc Tag)Human IL1RL1 / ST2 Protein (His Tag)Human IL1RL1 / DER4 ProteinHuman IL1R2 / CD121b Protein (Fc Tag)Human IL1R2 / IL1RB / CD121b Protein (His Tag)Human IL1R2 / IL1RB / CD121b ProteinHuman IL18 / Interleukin 18 / IGIF Protein (GST Tag)Human IL-1RAcP / IL-1R3 Protein (His & Fc Tag)Human IL-1RAcP / IL-1R3 Protein (His Tag)Human IL-1RA / IL1RN Protein (Fc Tag)Human IL-1RA / IL1RN ProteinHuman IL36G / IL1F9 Protein (aa 18-169, His Tag)Human IL36G / IL1F9 ProteinHuman IL36G / IL1F9 Protein (aa 18-169)Human IL1F5 / IL36RN ProteinHuman IL1R1 / CD121a Protein (Fc Tag)Human IL1R1 / CD121a Protein (His Tag)Human IL1R1 / CD121a ProteinHuman IL-1 alpha / IL1A / IL1F1 ProteinHuman IL-1 beta / IL1B Protein (pro form, His Tag)Human IL-1 beta / IL1B ProteinHuman IL37 / IL1F7 / IL-1H4 ProteinHuman IL-1R9 / IL1RAPL2 Protein (Fc Tag)Human IL-1R9 / IL1RAPL2 Protein (His Tag)Human IL18RAP / IL1R7 Protein (Fc Tag)Human IL18RAP / IL1R7 Protein (His Tag)Human IL-1R8 / IL1RAPL1 Protein (Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (His Tag)Human IL18BPa Protein (His & Fc Tag)Human IL18BPa Protein (His Tag)Human IL33 / Interleukin-33 / NF-HEV ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (His & GST Tag)Human MKK6 / MEK6 / MAP2K6 Protein (207 Ser/Asp, 211 Thr/Asp, His & GST Tag)Human MKK6 / MEK6 / MAP2K6 ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (207 Asp, 211 Asp)Human IL36B / IL1F8 Protein (His Tag)Human IL36B / IL1F8 ProteinHuman IL1F6 / IL36A Protein (His Tag)Human IL1F6 / IL36A ProteinHuman IL1F6 / IL36 Protein (aa 6-158)Mouse IL18RAP / IL1R7 Protein (His Tag)Sus scrofa (Pig) IL1B / IL-1 beta ProteinHuman JNK2 / MAPK9 Protein (His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Human JNK1 / MAPK8 Protein (GST Tag)Human IL18R1 / CD218a Protein (His & Fc Tag)Human IL18R1 / CD218a Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Human SIGIRR / TIR8 Protein (Fc Tag) Human SIGIRR / TIR8 Protein (His Tag)Human MARK3 / CTAK1 / EMK-2 Protein (His & GST Tag)Feline IL1B / IL-1 beta ProteinHuman IL1RL1 / ST2 Protein (isoform a, His Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Mouse IL18 / IL-18 ProteinMouse IL-18R1 Protein (His & Fc Tag)Mouse IL18R1 / CD218a Protein (His Tag)Mouse IL-1F6 / IL-1 epsilon ProteinMouse IL-1 beta / IL1B ProteinMouse IL-1 alpha / IL1A / IL1F1 ProteinMouse SIGIRR / TIR8 Protein (His & Fc Tag)Mouse IL18BP Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse MKK4 / MEK4 / MAP2K4 Protein (His & GST Tag)Mouse IL1RL1 / ST2 Protein (Fc Tag)Mouse IL1R1 / CD121a Protein (Fc Tag)Mouse IL1R1 / CD121a Protein (His Tag)Mouse IL-1R8 / IL1RAPL1 Protein (Fc Tag)Mouse IL1F8 / IL36b ProteinMouse IL1R2 / CD121b Protein (Fc Tag)Mouse IL1R2 / CD121b Protein (His Tag)Canine IL33 / Interleukin-33 / NF-HEV ProteinCanine IL-1 beta / IL1B ProteinRat IL-1 beta / IL1B Protein (pro form, His Tag)Rat IL-1 beta / IL1B Protein (mature form)Rat IL1R1 / CD121a Protein (His & Fc Tag)Rat IL1R1 / CD121a Protein (His Tag)Rat IL-1RA / IL1RN Protein (Fc Tag)Rat IL18R1 Protein (Fc Tag)Rat IL1R2 / IL1RB / CD121b Protein (His Tag)Mouse IL1RL1 / ST2 Protein (His Tag)Cynomolgus IL-1 beta / IL1B ProteinCynomolgus IL-18 / IL-1F4 Protein (His Tag)Cynomolgus IL1R2 / IL1RB Protein (Fc Tag)Cynomolgus IL18RAP Protein (Fc Tag)Cynomolgus IL18RAP Protein (His Tag)Cynomolgus IL1R1 Protein (Fc Tag)Cynomolgus IL1R1 Protein (His Tag)Human IL1F10 / IL-38 Protein (His Tag)Canine IL18R1 Protein (Fc Tag)

Interleukin 1 receptor, type I (IL-1R1) also known as CD121a (Cluster of Differentiation 121a), is an interleukin receptor. IL-1R1/CD121a is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein is a receptor for interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA). IL-1R1/CD121a is an important mediator involved in many cytokine induced immune and inflammatory responses. This protein has been characterized by pharmacological and molecular techniques in the mouse brain. The spindle-shaped astrocytes enclose the wound, separating the healthy from damaged neural tissue. The shape change and subsequent repair processes are IL-1β activity-dependent, acting through the IL-1 type 1 receptor (IL-1R1), as co-application of the IL-1type 1 receptor antagonist protein (IL-1ra) blocks IL-1β induced effects. In the spleen, a slight increase in IL-1R AcP and IL-1R1 was observed during the first hours following LPS stimulation. In conclusion, IL-1R AcP mRNA is expressed in the brain and in other tissues where IL-1R1/CD121a transcripts are found. However, the regulation of its expression is distinct from IL-1R1/CD121a. The high level of expression and the lack of regulation of IL-1R AcP transcripts in the brain under inflammatory conditions suggest that the protein might be constitutively expressed in excess.

  • Dale M, et al. (1999). "Interleukin-1 receptor cluster: gene organization of IL1R2, IL1R1, IL1RL2 (IL-1Rrp2), IL1RL1 (T1/ST2), and IL18R1 (IL-1Rrp) on human chromosome 2q.". Genomics 57 (1): 177-9.
  • Joos L, et al. (2001). "Association of IL-1beta and IL-1 receptor antagonist haplotypes with rate of decline in lung function in smokers.". Thorax 56 (11): 863-6.
  • Vigers GP, et al. (1997). "Crystal structure of the type-I interleukin-1 receptor complexed with interleukin-1beta.". Nature 386 (6621): 190-4.