After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey PTGFRN natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus PTGFRN cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:2640bp
cDNA Description:Full length Clone DNA of Macaca mulatta prostaglandin F2 receptor negative regulator.
Gene Synonym:PTGFRN
Species:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

EWI-F, also known as PTGFRN, is inversely related to the loss of CD9. Its expression correlates with the metastatic status of hLT (n=55). EWI-F inhibits the binding of prostaglandin F2-alpha (PGF2-alpha) to its specific FP receptor, by decreasing the receptor number rather than the affinity constant. EWI-F expression positively correlates with the metastatic status of hLT, and that the upregulation of EWI-F expression could be one of the mechanisms underlying the loss of CD9 in solid tumours.

References
  • Stipp C S. et al., 2001, J Biol Chem. 276 (7): 4853-62.
  • Charrin S. et al., 2001, J Biol Chem. 276 (17): 14329-37.
  • Orlicky DJ. et al., 1996, Hum Genet. 97 (5): 655-8.
  • Size / Price
    Catalog: CG90276-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"