Quick Order

Text Size:AAA

Cynomolgus monkey ART4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ART4cDNA Clone Product Information
cDNA Size:993
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ADP-ribosyltransferase 4 (Dombrock blood group) DNA.
Gene Synonym:ART4
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

ADP-ribosyltransferase 4 (Dombrock blood group), also known as Mono-ADP-ribosyltransferase 4(ART4), Dombrock blood group carrier molecule and CD297, is a protein that contains a mono-ADP-ribosylation (ART) motif. It is a member of the ADP-ribosyltransferase gene family but enzymatic activity has not been demonstrated experimentally. ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. ART4 could be detected on HEL cells and erythrocytes by FACS analysis while it was absent from activated monocytes, despite the presence of ART4 mRNA in these cells. ART is also known as the carrier of the Dombrock blood group alloantigens (Do) which is glycosylphosphatidylinosotol-anchored to the erythrocyte membrane.

  • Parusel I, et al. (2005) A panel of monoclonal antibodies recognizing GPI-anchored ADP-ribosyltransferase ART4, the carrier of the Dombrock blood group antigens. Cell Immunol. 236(1-2): 59-65.
  • Friedrich M, et al. (2005) Analysis of the 3' UTR of the ART3 and ART4 gene by 3' inverse RACE-PCR. DNA Seq. 16(1): 53-7.
  • Okazaki IJ, et al. (1998) Glycosylphosphatidylinositol-anchored and secretory isoforms of mono-ADP-ribosyltransferases. J Biol Chem. 273(37): 23617-20.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items