Quick Order

Text Size:AAA

Cynomolgus monkey ENPEP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
ENPEPcDNA Clone Product Information
Gene Bank Ref.ID:unsubmitted
cDNA Size:2874
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) glutamyl aminopeptidase (aminopeptidase A) DNA.
Gene Synonym:ENPEP
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

ENPEP, also known as aminopeptidase A, is a member of the peptidase M1 family. Members of this family are involved in response to cadmium ion and proteolysis. They located in 6 components and are expressed in 26 plant structures. ENPEP is expressed by epithelial cells of the proximal tubule cells and the glomerulus of the nephron. It also can be detected in a variety of other tissues. ENPEP probably plays a role in regulating growth and differentiation of early B-lineage cells. It also may play a role in the catabolic pathway of the renin-angiotensin system. ENPEP is a zinc-dependent membrane-bound aminopeptidase that catalyzes the cleavage of glutamatic and aspartatic amino acid residues from the N-terminus of polypeptides. It degrades vasoconstricting angiotensin II into angiotensin III and therefore helps to regulate blood pressure.

  • Speth RC, et al. (2008) The significance of brain aminopeptidases in the regulation of the actions of angiotensin peptides in the brain. Heart Fail Rev. 13(3):299-309.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Pérez I, et al. (2009) Increased APN/CD13 and acid aminopeptidase activities in head and neck squamous cell carcinoma. Head Neck. 31(10):1335-40.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availsability:2-3 weeks