After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey TFRC natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus TFRC cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:2283bp
cDNA Description:Full length Clone DNA of Macaca mulatta transferrin receptor (p90, CD71).
Gene Synonym:TFRC
Species:Cynomolgus
Vector:pCMV3-untagged
Plasmid:pCMV3-cynoTFRC
Restriction Site:KpnI (two restriction sites) + XbaI (6.10kb + 1.47kb + 0.81kb)
Tag Sequence:
Sequence Description:Identical with NM_001257303.1 [ Macaca mulatta (Rhesus monkey) ]: 2112 G/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus TFRC Gene Plasmid Map
Cynomolgus monkey TFRC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Mouse transferrin receptor protein 1, also known as transferrin receptor, Trfr, p90, CD71 and TFRC, is a single-pass type II membrane protein which belongs to the peptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.

References
  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.
  • Size / Price
    Catalog: CG90253-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"