Quick Order

Cynomolgus monkey BTLA natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus BTLA cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:870bp
cDNA Description:Full length Clone DNA of Macaca mulatta b- and T-lymphocyte attenuator-like.
Gene Synonym:BTLA
Species:Cynomolgus
Vector:pCMV3-untagged
Plasmid:pCMV3-cynoBTLA
Restriction Site:KpnI + XbaI (6.1kb + 0.87kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 333 C/G and 642 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus BTLA Gene Plasmid Map
Cynomolgus monkey BTLA natural ORF mammalian expression plasmid
Product nameProduct name
Background

BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such, reagents that regulate the binding of BTLA to its ligand or alter BTLA signaling have significant therapeutic promise. BTLA is crucial to understand the mechanism(s) of action of these antibodies before attempting clinical applications. BTLA is not expressed by naive T cells, but it is induced during activation and remains expressed on T helper type 1 (T(H)1) but not T(H)2 cells. BTLA is a third inhibitory receptor on T lymphocytes with similarities to cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and programmed death 1 (PD-1).

References
  • Fourcade J, et al. (2012) CD8(+) T cells specific for tumor antigens can be rendered dysfunctional by the tumor microenvironment through upregulation of the inhibitory receptors BTLA and PD-1. Cancer Res. 72(4):887-96.
  • Kojima R, et al. (2011) Molecular basis for herpesvirus entry mediator recognition by the human immune inhibitory receptor CD160 and its relationship to the cosignaling molecules BTLA and LIGHT. J Mol Biol. 413(4):762-72.
  • Oki M, et al. (2011) A functional polymorphism in B and T lymphocyte attenuator is associated with susceptibility to rheumatoid arthritis. Clin Dev Immunol. 305656.
  • Size / Price
    Catalog: CG90250-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"