Quick Order

Rhesus CD200 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus CD200 cDNA Clone Product Information
Gene_bank_ref_id:XM_001103685.2
RefSeq ORF Size:810bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD200 molecule.
Gene Synonym:CD200
Species:Rhesus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CD200 (OX-2) is a cell surface glycoprotein that imparts immune privileges by suppressing alloimmune and autoimmune responses through its receptor, CD200R, expressed primarily on myeloid cells. Signals delivered through the CD200:CD200R axis have been shown to play an important role in the regulation of anti-tumor immunity, and overexpression of CD200 has been reported in a number of malignancies, including CLL, as well as on cancer stem cells. The role of CD200-CD200R signaling in immune regulation of the central nervous system has become a popular field of research in recent years. Many studies have shown that there is a close correlation between CD200-CD200R, microglia activation, and Parkinson's disease (PD). The ability of CD200 to suppress myeloid cell activation is critical for maintaining normal tissue homeostasis but may also enhance the survival of migratory neoplastic cells. CD200 and CD200R associate via their respective N-terminal Ig-like domains. CD200 has been characterized as an important immunoregulatory molecule, increased expression of which can lead to decreased transplant rejection, autoimmunity, and allergic disease. Elevated CD200 expression has been reported to be associated with poor prognosis in a number of human malignancies. In addition, CD200 also plays an important role in prevention of graft rejection, autoimmune diseases and spontaneous abortion.

References
  • Minas K, et al. (2006) Is the CD200/CD200 receptor interaction more than just a myeloid cell inhibitory signal? Crit Rev Immunol. 26(3): 213-30.
  • Wang XJ, et al. (2007) CD200-CD200R regulation of microglia activation in the pathogenesis of Parkinson's disease. J Neuroimmune Pharmacol. 2(3): 259-64.
  • Wong KK, et al. (2010) The role of CD200 in immunity to B cell lymphoma. J Leukoc Biol. 88(2): 361-72.
  • Size / Price
    Catalog: CG90230-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"