Quick Order

Text Size:AAA

Cynomolgus monkey SIRPG natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus SIRPG cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:1164bp
cDNA Description:Full length Clone DNA of Macaca mulatta signal-regulatory protein gamma.
Gene Synonym:SIRPG
Species:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Signal-regulatory protein gamma (SIRPG/SIRP gamma) also known as CD172 antigen-like family member B, CD172g, and CD172g antigen, is a member of the signal-regulatory protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. SIRPG/SIRP gamma/CD172g is probable immunoglobulin-like cell surface receptor. On binding with CD47, SIRPG can mediate cell-cell adhesion. SIRPG/SIRP gamma is engagement on T-cells by CD47 on antigen-presenting cells results in enhanced antigen-specific T-cell proliferation and costimulates T-cell activation. SIRPG/SIRP gamma/CD172g is detected in liver, and at very low levels in brain, heart, lung, pancreas, kidney, placenta and skeletal muscle. Expressed on CD4+ T-cells, CD8+ T-cells, CD56-bright natural killer (NK) cells, CD20+ cells, and all activated NK cells. This cytokine is mainly present in the paracortical T-cell area of lymph nodes, with only sparse positive cells in the mantle and in the germinal center of B-cell follicles. In the thymus, SIRPG is primarily expressed in the medulla on mature T-lymphocytes that have undergone thymic selection.

References
  • Meador JA, et al. (2011) p53-independent downregulation of histone gene expression in human cell lines by high- and low-let radiation. Radiat Res. 175(6): 689-99.
  • Reddy MV, et al. (2011) Association between type 1 diabetes and GWAS SNPs in the southeast US Caucasian population. Genes Immun. 12(3): 208-12.
  • Kawasaki M, et al. (2009) Changes in the gene expression of peripheral blood mononuclear cells during the menstrual cycle of females is associated with a gender bias in the incidence of systemic lupus erythematosus. Clin Exp Rheumatol. 27(2): 260-6.
  • Size / Price
    Catalog: CG90226-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"