After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey ENPP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ENPP2cDNA Clone Product Information
cDNA Size:2592
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ectonucleotide pyrophosphatase/phosphodiesterase 2 DNA.
Gene Synonym:ENPP2
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

ENPP2 (Ectonucleotide pyrophosphatase/phosphodiesterase family member 2), also referred as Autotaxin, is a secreted enzyme encoded by the ENPP2 gene. This gene product stimulates the motility of tumor cells, has angiogenic properties, and its expression is upregulated in several kinds of carcinomas. The Autotaxin protein is important for generating the lipid signaling molecule lysophosphatidic acid (LPA), which is a potent mitogen, which facilitates cell proliferation and migration, neurite retraction, platelet aggregation, smooth muscle contraction, actin stress formation and cytokine and chemokine secretion. ATX has been found to catalyze the formation of cyclic phosphatidic acid (cPA), which have antitumor role by antimitogenic regulation of cell cycle, inhibition of cancer invasion and metastasis. LPA receptors and ATX are upregulated in numerous cancer cell types and show expression patterns that correlate with tumor cell invasiveness. Thus, Autotaxin has recently emerged as an attractive target for the development of anti-cancer chemotherapeutics. In addition, Serum ATX activity was found to be enhanced in relation to hepatic fibrosis in chronic liver disease due to hepatitis virus C infection.

  • Tania M, et al. (2010) Autotaxin: a protein with two faces. Biochem Biophys Res Commun. 401(4): 493-7.
  • Ikeda H, et al. (2009) Significance of serum autotaxin activity in gastrointestinal disease. Rinsho Byori. 57(5): 445-9.
  • Parrill AL, et al. (2008) Autotaxin inhibition: challenges and progress toward novel anti-cancer agents. Anticancer Agents Med Chem. 8(8): 917-23.
  • Pradere J.P, et al. (2007) Secretion and lysophospholipase D activity of autotaxin by adipocytes are controlled by N-glycosylation and signal peptidase. Biochim Biophys Acta. 1771: 93-102.
  • Boucher J, et al. (2005) Potential involvement of adipocyte insulin resistance in obesity-associated up-regulation of adipocyte lysophospholipase D/autotaxin expression. Diabetologia. 48: 569-77.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks