After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey ITGAV natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus ITGAV cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:3147bp
cDNA Description:Full length Clone DNA of Macaca mulatta integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51).
Gene Synonym:ITGAV
Species:Cynomolgus
Vector:pCMV3-untagged
Plasmid:pCMV3-cynoITGAV
Restriction Site:KpnI + XbaI (6.1kb + 3.15kb)
Tag Sequence:
Sequence Description:Identical with XM_001104012.1 [ Macaca mulatta (Rhesus monkey) ]: 279 T/A, 1503 T/C, 1710 G/A, 2403 C/T not causing the amino acid variation. Please check the sequence information before order.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: CG90194-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"