Quick Order

Rhesus CD58 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Cynomolgus CD58 cDNA Clone Product Information
NCBI RefSeq:XM_001112756.1
RefSeq ORF Size:714bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD58 molecule.
Gene Synonym:CD58
Species:Rhesus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CD53 is a member of the transmembrane 4 superfamily, also called the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. These proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. CD53 is a cell surface glycoprotein that is known to complex with integrins. Familial deficiency of CD53 gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. CD53 contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation.

References
  • Rochelle JM. et al., 1993, Int Immunol. 5 (2): 209-16.
  • Virtaneva KI. et al., 1993, Immunogenetics. 37 (6): 461-5.
  • Horejsí V. et al., 1991, FEBS Lett. 288 (1-2): 1-4.
  • Size / Price
    Catalog: CG90190-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"