Quick Order

Rhesus CD59 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Cynomolgus CD59 cDNA Clone Product Information
NCBI RefSeq:XM_001083003.2
RefSeq ORF Size:387bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD59 molecule, complement regulatory protein.
Gene Synonym:CD59
Species:Rhesus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CD59 glycoprotein, also known as 20 kDa homologous restriction factor, HRF20, MAC-inhibitory protein, Membrane attack complex inhibition factor, Membrane inhibitor of reactive lysis, MIC11, MIRL and CD59, is a cell membrane protein which contains one UPAR/Ly6 domain. CD59 is a small, highly glycosylated, GPI-linked protein, with a wide expression profile. The soluble form of CD59 from urine retains its specific complement binding activity, but exhibits greatly reduced ability to inhibit MAC assembly on cell membranes. CD59 is a potent inhibitor of the complement membrane attack complex (MAC) action. CD59 was first identified as a regulator of the terminal pathway of complement. It acts by binding to the C8 and/or C9 complements of the assembling MAC, thereby preventing incorporation of the multiple copies of C9 required for complete formation of the osmolytic pore. This inhibitor appears to be species-specific. CD59 is involved in signal transduction for T-cell activation complexed to a protein tyrosine kinase. Defects in CD59 are the cause of CD59 deficiency (CD59D).

References
  • Fletcher CM. et al., 1994, Structure. 2: 185-99.
  • Rudd PM. et al., 1997, J Biol Chem. 272: 7229-44.
  • Kimberley FC. et al., 2007, Mol Immunol. 44 (1-3): 73-81.
  • Gong Y. et al., 2007, Sci China C Life Sci. 50 (6): 773-9.
  • Picariello G. et al., 2008, Proteomics 8: 3833-47.
  • Heibeck TH. et al., 2009, J Proteome Res. 8: 3852-61.
  • Size / Price
    Catalog: CG90188-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"