After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cynomolgus monkey SELE Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SELEcDNA Clone Product Information
cDNA Size:1833
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) selectin E DNA.
Gene Synonym:SELE
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

E-selectin, also known as endothelial leukocyte adhesion molecule-1 (ELAM-1) and CD62E, is an inducible adhesion molecule that is expressed on the surfaces of stimulated vascular endothelial cells and is sometimes involved in cancer cell metastasis. E-selectin exhibits a complex mosaic structure consisting of a large extracellular region comprised of a lectin domain, an EGF-like domain, and a short consensus repeat (SCR) domain, followed by a transmembrane region and a relatively short (32 aa) cytoplasmic tail. As a member of the LEC-CAM or selectin family, E-selectin recognises and binds to sialylated carbohydrates including members of the Lewis X and Lewis A families found on monocytes, granulocytes, and T-lymphocytes. E-selectin supports rolling and stable arrest of leukocytes on activated vascular endothelium, and furthermore, it was indicated that it can also transduce an activating stimulus via the MAPK cascade into the endothelial cell during leukocyte adhesion. E-selectin regulates adhesive interactions between certain blood cells and endothelium. The soluble form of E selectin (sE-selectin) is a marker of endothelial activation, and has a potential role in the pathogenesis of cardiovascular disease as raised levels have been found in hypertension, diabetes and hyperlipidemia, although its association in established atherosclerosis disease and its value as a prognostic factor is more controversial. soluble E-selectin is inversely associated with the muscular component of the left ventricle, thereby suggesting that the lack of such a reparative factor may be associated with cardiac remodeling in end-stage renal disease (ESRD) patients. In addition, this adhesion molecule appears to be involved in the pathogenesis of atherosclerosis.

  • Roldn V, et al. (2003) Soluble E-selectin in cardiovascular disease and its risk factors. A review of the literature. Thromb Haemost. 90(6): 1007-20.
  • Kawase J, et al. (2009) Increase in E-selectin expression in umbilical vein endothelial cells by anticancer drugs and inhibition by cimetidine. Oncol Rep. 22(6): 1293-7.
  • Matsumoto K, et al. (2010) Soluble adhesion molecule E-selectin predicts cardiovascular events in Japanese patients with type 2 diabetes mellitus. Metabolism. 59(3): 320-4.
  • Stancanelli B, et al. (2010) Soluble e-selectin is an inverse and independent predictor of left ventricular wall thickness in end-stage renal disease patients. Nephron Clin Pract. 114(1): c74-80.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items