Quick Order

Rhesus IL27RA natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Cynomolgus IL27RA cDNA Clone Product Information
NCBI RefSeq:XM_001111176.2
RefSeq ORF Size:1911bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interleukin 27 receptor, alpha.
Gene Synonym:IL27RA
Species:Rhesus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Human IL-12 Protein (IL12A & IL12B Heterodimer) Protein (His Tag)Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Human IL-23 (IL12B & IL23A Heterodimer) Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL23A & Mouse IL12B Heterodimer Protein (His Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12B / P40 Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL27 / Interleukin-27 Protein (His Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12RB1 / IL12RB / CD212 Protein (His Tag)Rat IL-23 (IL23A & IL12B Heterodimer) ProteinHuman IL23R / IL23 Receptor Protein (Fc Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL12B / IL-12B Protein (Fc Tag)Mouse IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinRhesus IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL27 / Interleukin-27 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Rhesus IL12A / NKSF1 Protein (Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Rhesus IL6ST / gp130 Protein (His Tag)Marmoset IL12B / IL-12B Protein (Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL-23 (IL23A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-23 (IL23A & IL12B Heterodimer) ProteinMarmoset IL-23 (IL23A & IL12B Heterodimer) ProteinHuman IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL12A & IL27B Heterodimer Protein
Background

The interleukin-27 receptor is a type I cytokine receptor for interleukin-27. It is a heterodimer composed of the interleukin 27 receptor, alpha subunit and glycoprotein 130. WSX-1/IL-27R, a class I cytokine receptor that is homologous to the β2 chain of the IL-12R in both sequence and structure, is highly expressed by resting/naive CD4+ T cells and CD8+ T cells. WSX-1/IL-27R belongs to the IL-6/IL-12 family of cytokines and induced proliferation of naive CD4(+) T cells and the generation of a Th1-type adaptive immune response. WSX-1/IL-27R functions as a receptor for IL27. IL-27 not only contributes to the development of an adaptive immune response through its action on CD4(+) T cells, it also directly acts on cells of the innate immune system. WSX-1/IL-27R requires IL6ST/gp130 to mediate signal transduction in response to IL27. This signaling system acts through STAT3 and STAT1. It is involved in the regulation of Th1-type immune responses. IL-27R also appears to be involved in innate defense mechanisms. IL27RA is essential for transcriptional activation of STAT1 and for augmenting the induction of T-bet expression during initiation of Th1 cell differentiation.

References
  • Pflanz S, et al.. (2004) WSX-1 and glycoprotein 130 constitute a signal-transducing receptor for IL-27. J Immunol. 172(4): 2225-31.
  • Yoshida H, et al.. (2001) WSX-1 is required for the initiation of Th1 responses and resistance to L. major infection. Immunity. 215(4): 569-78.
  • Villarino A, et al.. (2003) The IL-27R (WSX-1) is required to suppress T cell hyperactivity during infection. Immunity. 19(5): 645-55.
  • Size / Price
    Catalog: CG90129-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"