After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey IL10RA natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus IL10RA cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:1773bp
cDNA Description:Full length Clone DNA of Macaca mulatta interleukin 10 receptor, alpha.
Gene Synonym:IL10RA
Species:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Background

CD219, also known as IL10RA, is a receptor for interleukin 10. CD219 has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. It is structurally related to IFN receptors. It has been reported that CD219 promotes survival of progenitor myeloid cells. Activation of CD219 leads to tyrosine phosphorylation of JAK1 and TYK2 kinases.

References
  • Josephson K, et al. (2001) Purification, crystallization and preliminary X-ray diffraction of a complex between IL-10 and soluble IL-10R1. Acta Crystallogr D Biol Crystallogr. 57(Pt 12): 1908-11.
  • Tan, J C, et al. (1995) Characterization of recombinant extracellular domain of human interleukin-10 receptor. J Biol Chem. 270(21):12906-11.
  • Josephson, K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15(1):35-46.
  • Size / Price
    Catalog: CG90125-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"