After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey CD64 / FCGR1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus FCGR1 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:1074bp
cDNA Description:Full length Clone DNA of Macaca mulatta high affinity immunoglobulin gamma Fc receptor I.
Gene Synonym:FCGR1
Species:Cynomolgus
Vector:pCMV3-untagged
Plasmid:pCMV3-cynoFCGR1
Restriction Site:KpnI + XbaI (6.1kb + 1.07kb)
Tag Sequence:
Sequence Description:Identical with JQ037994.2 [ Macaca mulatta (Rhesus monkey) ] sequence. Please check the sequence information before order.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus FCGR1 Gene Plasmid Map
Cynomolgus monkey CD64 / FCGR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral membrane glycoprotein and a member of the immunoglobulin superfamily. CD64 is a high affinity receptor for the Fc region of IgG gamma and functions in both innate and adaptive immune responses. Receptors that recognize the Fc portion of IgG function in the regulation of immune response and are divided into three classes designated CD64, CD32, and CD16. CD64 is structurally composed of a signal peptide that allows its transport to the surface of a cell, three extracellular immunoglobulin domains of the C2-type that it uses to bind antibody, a hydrophobic transmembrane domain, and a short cytoplasmic tail. CD64 is constitutively found on only macrophages and monocytes, but treatment of polymorphonuclear leukocytes with cytokines like IFNγ and G-CSF can induce CD64 expression on these cells. The inactivation of the mouse CD64 resulted in a wide range of defects in antibody Fc-dependent functions. Mouse CD64 is an early participant in Fc-dependent cell activation and in the development of immune responses.

Size / Price
Catalog: CG90017-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"