After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey IL18 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL18cDNA Clone Product Information
cDNA Size:582
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) interleukin 18 (interferon-gamma-inducing factor) DNA.
Gene Synonym:IL18
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
IL-1 Family & Receptor Related Products
Product nameProduct name
Canine IL1R2 / IL1RB Protein (Fc Tag)Rat IL18R1 Protein (His Tag)Mouse IL36G / IL1F9 Protein (His Tag)Cynomolgus IL18R1 Protein (Fc Tag)Rabbit IL-1 beta / IL1B ProteinHuman p38 alpha / MAPK14 Protein (Activated in vitro, His Tag)Human IL18 / IL-18 ProteinCanine IL18R1 Protein (ECD, His Tag)Human IL1RL2 / IL-1Rrp2 Protein (Fc Tag)Cynomolgus IL18R1 Protein (His Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL1RL1 / DER4 Protein (Fc Tag)Human IL1RL1 / ST2 Protein (His Tag)Human IL1RL1 / DER4 ProteinHuman IL1R2 / CD121b Protein (Fc Tag)Human IL1R2 / IL1RB / CD121b Protein (His Tag)Human IL1R2 / IL1RB / CD121b ProteinHuman IL18 / Interleukin 18 / IGIF Protein (GST Tag)Human IL-1RAcP / IL-1R3 Protein (His & Fc Tag)Human IL-1RAcP / IL-1R3 Protein (His Tag)Human IL-1RA / IL1RN Protein (Fc Tag)Human IL-1RA / IL1RN ProteinHuman IL36G / IL1F9 Protein (aa 18-169, His Tag)Human IL36G / IL1F9 ProteinHuman IL36G / IL1F9 Protein (aa 18-169)Human IL1F5 / IL36RN ProteinHuman IL1R1 / CD121a Protein (Fc Tag)Human IL1R1 / CD121a Protein (His Tag)Human IL1R1 / CD121a ProteinHuman IL-1 alpha / IL1A / IL1F1 ProteinHuman IL-1 beta / IL1B Protein (pro form, His Tag)Human IL-1 beta / IL1B ProteinHuman IL37 / IL1F7 / IL-1H4 ProteinHuman IL-1R9 / IL1RAPL2 Protein (Fc Tag)Human IL-1R9 / IL1RAPL2 Protein (His Tag)Human IL18RAP / IL1R7 Protein (Fc Tag)Human IL18RAP / IL1R7 Protein (His Tag)Human IL-1R8 / IL1RAPL1 Protein (Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (His Tag)Human IL18BPa Protein (His & Fc Tag)Human IL18BPa Protein (His Tag)Human IL33 / Interleukin-33 / NF-HEV ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (His & GST Tag)Human MKK6 / MEK6 / MAP2K6 Protein (207 Ser/Asp, 211 Thr/Asp, His & GST Tag)Human MKK6 / MEK6 / MAP2K6 ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (207 Asp, 211 Asp)Human IL36B / IL1F8 Protein (His Tag)Human IL36B / IL1F8 ProteinHuman IL1F6 / IL36A Protein (His Tag)Human IL1F6 / IL36A ProteinHuman IL1F6 / IL36 Protein (aa 6-158)Mouse IL18RAP / IL1R7 Protein (His Tag)Sus scrofa (Pig) IL1B / IL-1 beta ProteinHuman JNK2 / MAPK9 Protein (His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Human JNK1 / MAPK8 Protein (GST Tag)Human IL18R1 / CD218a Protein (His & Fc Tag)Human IL18R1 / CD218a Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Human SIGIRR / TIR8 Protein (Fc Tag) Human SIGIRR / TIR8 Protein (His Tag)Human MARK3 / CTAK1 / EMK-2 Protein (His & GST Tag)Feline IL1B / IL-1 beta ProteinHuman IL1RL1 / ST2 Protein (isoform a, His Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Mouse IL18 / IL-18 ProteinMouse IL-18R1 Protein (His & Fc Tag)Mouse IL18R1 / CD218a Protein (His Tag)Mouse IL-1F6 / IL-1 epsilon ProteinMouse IL-1 beta / IL1B ProteinMouse IL-1 alpha / IL1A / IL1F1 ProteinMouse SIGIRR / TIR8 Protein (His & Fc Tag)Mouse IL18BP Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse MKK4 / MEK4 / MAP2K4 Protein (His & GST Tag)Mouse IL1RL1 / ST2 Protein (Fc Tag)Mouse IL1R1 / CD121a Protein (Fc Tag)Mouse IL1R1 / CD121a Protein (His Tag)Mouse IL-1R8 / IL1RAPL1 Protein (Fc Tag)Mouse IL1F8 / IL36b ProteinMouse IL1R2 / CD121b Protein (Fc Tag)Mouse IL1R2 / CD121b Protein (His Tag)Canine IL33 / Interleukin-33 / NF-HEV ProteinCanine IL-1 beta / IL1B ProteinRat IL-1 beta / IL1B Protein (pro form, His Tag)Rat IL-1 beta / IL1B Protein (mature form)Rat IL1R1 / CD121a Protein (His & Fc Tag)Rat IL1R1 / CD121a Protein (His Tag)Rat IL-1RA / IL1RN Protein (Fc Tag)Rat IL18R1 Protein (Fc Tag)Rat IL1R2 / IL1RB / CD121b Protein (His Tag)Mouse IL1RL1 / ST2 Protein (His Tag)Cynomolgus IL-1 beta / IL1B ProteinCynomolgus IL-18 / IL-1F4 Protein (His Tag)Cynomolgus IL1R2 / IL1RB Protein (Fc Tag)Cynomolgus IL18RAP Protein (Fc Tag)Cynomolgus IL18RAP Protein (His Tag)Cynomolgus IL1R1 Protein (Fc Tag)Cynomolgus IL1R1 Protein (His Tag)Human IL1F10 / IL-38 Protein (His Tag)Canine IL18R1 Protein (Fc Tag)

Interleukin-18 (IL-18, also known as interferon-gamma inducing factor) is a proinflammatory cytokine that belongs to the IL-1 superfamily and is produced by macrophages and other cells. This cytokine can induce the IFN-gamma production of T cells. The combination of IL-18 and IL12 has been shown to inhibit IL4 dependent IgE and IgG1 production, and enhance IgG2a production of B cells. IL-18 binding protein (IL18BP) can specifically interact with this cytokine, and thus negatively regulate its biological activity. IL-18 is an IL-1−like cytokine that requires cleavage with caspase-1 to become active, was found to increase IgE production in a CD4+ T cells-, IL-4− and STAT6−dependent fashion. IL-18 and T cell receptor−mediated stimulation could induce naïve CD4+ T cells to develop into IL-4−producing cells in vitro. Thus, caspase-1 and IL-18 may be critical in regulation of IgE production in vivo, providing a potential therapeutic target for allergic disorders. IL-18 production in primary synovial cultures and purified synovial fibroblasts was, in turn, upregulated by TNF-α and IL-1β, suggesting that monokine expression can feed back to promote Th1 cell development in synovial membrane. Besides, synergistic combinations of IL-18, IL-12, and IL-15 may be of importance in sustaining both Th1 responses and monokine production in RA.

  • Dinarello CA. (1999) IL-18: A TH1-inducing, proinflammatory cytokine and new member of the IL-1 family. J Allergy Clin Immunol. 103: 11-24.
  • Takeda K, et al.. (1998) Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity. 8(3): 383-90.
  • Gracie JA, et al.. (1999) A proinflammatory role for IL-18 in rheumatoid arthritis. J Clin Invest. 104(10): 1393-401.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items