After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cynomolgus monkey CXCL12 / SDF1b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCL12cDNA Clone Product Information
cDNA Size:270
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chemokine (C-X-C motif) ligand 12 DNA.
Gene Synonym:Img, LIG-1, D6Bwg0781e, Lrig1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Cynomolgus monkey CXCL12 / SDF1b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Chemokine & Receptor Related Products
Product nameProduct name

The human stromal cell-derived factor-1 (SDF1), also known as CXCL12, is a small (8 kDa) cytokine highly conserved chemotactic cytokine belonging to the large family of CXC chemokines. SDF1 is expressed in two isoforms from a single gene that encodes two splice variants, SDF1α and SDF1β, which are identical except for the four residues present in the C-terminus of SDF1β but absent from SDF1α. The chemokine CXCL12 [stromal cell-derived factor-1 (SDF-1)] binds primarily to CXC receptor 4 (CXCR4; CD184). The binding of CXCL12 to CXCR4 induces intracellular signaling through several divergent pathways initiating signals related to chemotaxis, cell survival and/or proliferation, increase in intracellular calcium, and gene transcription. CXCL12 and CXCR4 that have been widely characterized in peripheral tissues and delineate their main functions in the CNS. Extensive evidence supports CXCL12 as a key regulator for early development of the CNS. In the mature CNS, CXCL12 modulates neurotransmission, neurotoxicity and neuroglial interactions. CXCL12 has crucial roles in the formation of multiple organ systems during embryogenesis and in the regulation of bone marrow haematopoiesis and immune function in the postnatal organism. Although considered an important factor in normal bone metabolism, recent studies implicate CXCL12 in the pathogenesis of several diseases involving the skeleton, including rheumatoid arthritis and cancers that metastasize to bone. The CXCL12/CXCR4 axis is involved in tumor progression, angiogenesis, metastasis, and survival. Pathologically enhanced CXCL12 signaling may promote the formation of new vessels through recruiting circulating endothelial progenitor cells or directly enhancing the migration/growth of endothelial cells. Therefore, CXCL12 signaling represents an important mechanism that regulates brain tumor angiogenesis/vasculogenesis and may provide potential targets for anti-angiogenic therapy in malignant gliomas.

  • Bleul, C.C. et al., 1996, Nature. 382: 829-833.
  • Sapede, D. et al., 2005, Proc. Natl. Acad. Sci. USA. 102: 1714-1718.
  • Delgado, M.B. et al., 2001, Eur. J. Immunol. 31: 699-707.
  • Orimo, A. et al., 2005, Cell. 121: 335-348.
  • Kryczek, I. et al., 2007, Am. J. Physiol. Cell. Physiol. 292: C987-995.
  • Bbalabanian, K. et al., 2005, J. Biol. Chem. 280: 35760-35766.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items