After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human STK10 ORF mammalian expression plasmid, Flag tag

DatasheetReviewsRelated ProductsProtocols
Human STK10 cDNA Clone Product Information
NCBI RefSeq:NM_005990
RefSeq ORF Size:2907bp
cDNA Description:Full length Clone DNA of Homo sapiens serine/threonine kinase 10 with Flag tag.
Gene Synonym:LOK, PRO2729, STK10
Restriction Site:KpnI (two restriction sites) + XbaI (5.4kb + 1.5kb + 1.45kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations 756 G/A, 783 T/C and 2619 T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human STK10 Gene Plasmid Map
Human STK10 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human STK10 ORF mammalian expression plasmid, Flag tag on other vectors
Product nameProduct name

Serine / threonine-protein kinase 10, also known as Lymphocyte-oriented kinase, STK10 and LOK, which belongs to the protein kinase superfamily, STE Ser / Thr protein kinase family and STE20 subfamily. Protein kinases constitute a large superfamily of enzymes with key regulatory functions in nearly all signal transmission processes of eukaryotic cells. The Ste20 family of serine/threonine kinases plays an important role in numerous cellular functions such as growth, apoptosis, and morphogenesis. STK10 is similar to several known polo-like kinase kinases. It can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. STK10 can also negatively regulate interleukin 2 expression in T-cells via the mitogen activated protein kinase kinase 1 pathway. Stk10 can associate with Plk1 in cells and furthermore can phosphorylate Plk1. It can also act on substrates such as myelin basic protein and histone 2A on serine and threonine residues.

  • Kuramochi S, et al., 1997, J. Biol. Chem. 272 (36): 22679-84.
  • Kuramochi S, et al., 1999, Immunogenetics. 49 (5): 369-75. 
  • Walter, SA. et al., J Biol Chem 2003, 278 (20):18221-8.
  • Size / Price
    Catalog: HG11724-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.