Quick Order

Text Size:AAA

Human NAALADL1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NAALADL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_005468.2
RefSeq ORF Size:2222bp
cDNA Description:Full length Clone DNA of Homo sapiens N-acetylated alpha-linked acidic dipeptidase-like 1 with Flag tag.
Gene Synonym:I100, NAALADASEL, NAALADL1
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-NAALADL1-flag
Restriction Site:KpnI (two restriction sites) + XhoI (5.4kb + 0.71kb + 1.55kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human NAALADL1 ORF mammalian expression plasmid, Flag tag on other vectors
Product nameProduct name
Background

N-acetylated-alpha-linked acidic dipeptidase-like protein, also known as NAALADL1, NAALADase L, and Ileal dipeptidylpeptidase, is a Single-pass type I I membrane protein and a member of the peptidase M28 family and M28B subfamily. NAALADase L is mainly expressed in the distal small intestine. It is also expressed in the spleen and testis and Weakly expressed in the brain, locating mainly to the brain stem, amygdala, thalamus and ventral striatum. NAALADase L is a chloride-activated, membrane bound, metallopeptidase that cleaves the endogenous neuropeptide N-acetyl-aspartyl-glutamate (NAAG). NAAG acts as a partial NMDA agonist as well as a full agonist at the presynaptic metabotropic glutamate receptor 3 (mGluR3), where it acts to reduce glutamate release. NAALADase L also exhibits a dipeptidyl-peptidase IV type activity. NAALADase inhibition may be a novel therapeutic approach to reduce or inhibit heightened aggressiveness, and possibly to treat aggressive behavior associated with psychiatric disorders.

References
  • Stauch BL. 1989, Neurosci Lett. 100 (1-3): 295-300.
  • Shneider BL. et al., 1997, J. Biol. Chem. 272: 31006-15.
  • Pangalos MN. et al., 1999, J. Biol. Chem. 274: 8470-83.
  • Thomas AG. et al., 1999, Brain Res. 843 (1-2): 48-52.
  • Size / Price
    Catalog: HG11146-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"