Quick Order

Text Size:AAA

Human ITCH ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ITCH cDNA Clone Product Information
RefSeq ORF Size:2589bp
cDNA Description:Full length Clone DNA of Homo sapiens itchy E3 ubiquitin protein ligase homolog (mouse) with Flag tag.
Gene Synonym:AIF4, AIP4, NAPP1, dJ468O1.1, ITCH
Restriction Site:KpnI + NotI (5.4kb + 2.64kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human ITCH ORF mammalian expression plasmid, Flag tag on other vectors
Product nameProduct name

E3 ubiquitin-protein ligase Itchy homolog, also known as Atrophin-1-interacting protein 4, NFE2-associated polypeptide 1, NAPP1 and ITCH, is a cell membrane protein which contains one C2 domain, one HECT (E6AP-type E3 ubiquitin-protein ligase) domain and contains four WW domains. ITCH acts as an E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. It catalyzes 'Lys-29'-, 'Lys-48'- and 'Lys-63'-linked ubiquitin conjugation. ITCH is involved in the control of inflammatory signaling pathways. It is an essential component of a ubiquitin-editing protein complex, comprising also TNFAIP3, TAX1BP1 and RNF11, that ensures the transient nature of inflammatory signaling pathways. ITCH promotes the association of the complex after TNF stimulation. Once the complex is formed, TNFAIP3 deubiquitinates 'Lys-63' polyubiquitin chains on RIPK1 and catalyzes the formation of 'Lys-48'-polyubiquitin chains. This leads to RIPK1 proteosomal degradation and consequently termination of the TNF- or LPS-mediated activation of NFKB1. Defects in ITCH are the cause of syndromic multisystem autoimmune disease (SMAD) which is characterized by organomegaly, failure to thrive, developmental delay, dysmorphic features and autoimmune inflammatory cell infiltration of the lungs, liver and gut.

  • Marchese A. et al., 2003, Dev. Cell 5:709-22.
  • Wang Y. et al., 2006, EMBO J. 25: 5058-70.
  • Bhandari D. et al., 2009, Mol. Biol. Cell 20:1324-39.
  • Edwards TL. et al., 2009, Biochem. J. 423:31-9.
  • Zhang P. et al., 2010, J. Biol. Chem. 285:8869-79.
  • Azakir B.A. et al., 2010, FEBS J. 277:1319-30.
  • Size / Price
    Catalog: HG11131-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions