Quick Order

Human CES3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CES3cDNA Clone Product Information
cDNA Size:1716
cDNA Description:ORF Clone of Homo sapiens carboxylesterase 3 DNA.
Gene Synonym:ES31; FLJ21736; CES3
Restriction Site:
Sequence Description:
Shipping_carrier:Whatman FTA elute card (Cat: WB120410) contains 5-10 μg of plasmid.
Storage:The Whatman FTA elute card can be stored at room temperature for three months under dry condition.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Carboxylesterases hydrolyze esters of short-chain fatty acids and have roles in animals ranging from signal transduction to xenobiotic detoxification. In enzymology, a carboxylesterase is an enzyme that catalyzes the chemical reaction: a carboxylic ester + H2O = an alcohol + a carboxylate. Most enzymes from this group belong to the superfamily of hydrolases with alpha/beta protein fold (so called Alpha/beta hydrolase fold), specifically those acting on carboxylic ester bonds. The carboxylesterase family of evolutionarily related proteins (those with clear sequence homology to each other) includes a number of proteins with different substrate specificities, such as acetylcholinesterases. Carboxylesterase 3, also known as Liver carboxylesterase 31 homolog and CES3, is a endoplasmic reticulum lumen which belongs to the type-B carboxylesterase/lipase family. CES3 is involved in the detoxification of xenobiotics and in the activation of ester and amide prodrugs. CES3 shows low catalytic efficiency for hydrolysis of CPT-11, a prodrug for camptothecin used in cancer therapeutics. CES3 is expressed in liver, colon and small intestine.

  • Augusteyn RC. et al.,1969, Biochim Biophys Acta. 171 (1): 128-37.
  • Saito S. et al., 2003, J. Hum. Genet. 48: 249-70.
  • Sanghani SP. et al., 2003, Clin Cancer Res. 9: 4983-91.
  • Sanghani SP. et al., 2004, Drug Metab Dispos. 32: 505-11.
  • Chen R. et al., 2009, J Proteome Res. 8: 651-61.
  • Size / Price
    List Price: $395.00  (Save $80.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human CES3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items