After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CES2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human CES2 Gene Plasmid Map
Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Carboxylesterase 2 (CES2) is a member of the carboxylesterase family and belongs to the multigene family. Carboxylesterase 2 is responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and beroin. It also serves to hydrolyze long-chain fatty acid esters and thioesters. It is speculated that carboxylesterases may play a role in lipid metabolism and the blood-brain barrier system and together with isform 1, are a serine esterase involved in both drug metabolism and activation. Human carboxylesterase 2 is commonly expressed in tumor tissues and irinotecan, a topoisomerase I inhibitor commonly used in the treatment of many solid tumors.

References
  • Imai T. et al. (2006) Human carboxylesterase isozymes: catalytic properties and rational drug design. Drug metab pharmacokinet. 21 (3): 173-85.
  • Guang Xu, et al. (2002) Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan. Clin Cancer Res. 8: 2605.
  • Zhang, et al. (2002) Comprehensive Evaluation of Carboxylesterase-2 Expression in Normal Human Tissues Using Tissue Array Analysis. Applied Immunohistochemistry & Molecular Morphology. 10 (4): 374-80.
  • Images
    • Human CES2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"