After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H1N1 (A/California/07/2009) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H1N1 M1 cDNA Clone Product Information
RefSeq ORF Size:759bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/California/07/2009) Matrix protein 1 / M1 DNA.
Gene Synonym:Matrix protein 1, M1
Restriction Site:KpnI + XhoI (5.5kb + 0.76kb)
Tag Sequence:
Sequence Description:The translated amino acid sequence is identical with YP_009118623.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H1N1 M1 Gene Plasmid Map
Influenza A H1N1 (A/California/07/2009) Matrix protein 1 / M1 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
Influenza A H1N1 (A/California/07/2009) Matrix protein 1 / M1 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name