Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSNK1G2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Casein kinase I gamma 2 isoform (CSNK1G2), a member of the large casein kinase I (CKI) subfamily, protein kinase superfamily. It may affect the development of brain, and associate with vesicular trafficking and neurotransmitter releasing from small synaptic vesicles. The CKI family includes several other isoforms (alpha, beta, gamma, and delta). Dishevelled (Dsh), another positive component of the Wnt pathway, becomes phosphorylated in response to Wnt signals. All the CKI isoforms, with the exception of gamma, increase the phosphorylation of Dsh in vivo. Casein kinase 1 gamma (CK1gamma, or CSNK1G) is associated with the cell membrane and binds to LRP. CK1gamma was found to be needed for Wnt signaling through Wnt receptor LRP. CSNK1G2 inhibits Smad3-mediated TGF-beta responses including induction of target genes and cell growth arrest, and this inhibition is dependent on CSNK1G2 kinase activity. The overexpression of CSNK1G2 in human cancers, may act as an oncoprotein during tumorigenesis. In addition, as an MTA1s-binding protein, CSNK1G2 could further potentiate the estrogen receptor (ER) corepressive function of MTA1s.

References
  • McKay RM, et al. (2001) The casein kinase I family in Wnt signaling. Dev Biol. 235(2): 388-96.
  • Mishra SK, et al. (2004) Metastatic tumor antigen 1 short form (MTA1s) associates with casein kinase I-gamma2, an estrogen-responsive kinase. Oncogene. 23(25): 4422-9.
  • Yinan M, et al. (2004) Polymorphisms of casein kinase I gamma 2 gene associated with simple febrile seizures in Chinese Han population. Neurosci Lett. 368(1): 2-6.
  • Davidson G, et al. (2005). Casein kinase 1 gamma couples Wnt receptor activation to cytoplasmic signal transduction. Nature. 438 (7069): 867-72.
  • Guo X, et al. (2008) Ligand-dependent ubiquitination of Smad3 is regulated by casein kinase 1 gamma 2, an inhibitor of TGF-beta signaling. Oncogene. 27(58): 7235-47.
  • Images
    • Human CSNK1G2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"