After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LYPLA2cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Lysophospholipase II (LYPLA2, LPL-II, or LysoPLA II), also known as Acyl-protein thioesterase 2 (APT-2), belongs to the AB hydrolase 2 family. This enzyme has lysophospholipase activity, and may hydrolyze fatty acids from S-acylated cysteine residues in proteins such as trimeric G alpha proteins or HRAS. Acyl-protein thioesterase 1 (APT-1) and Acyl-protein thioesterase 2 (APT-2) are cytosolic lysophospholipid hydrolyzing enzymes. The serum activity of APT-1 may play an important role in determination of the concentration of des-acyl ghrelin in circulation, especially under septic inflammation. APT-2/LYPLA2 is expressed both in CHO-K1 and HeLa cells and its overexpression increased the deacylation rate of single acylated GAP-43 and affected the steady-state localization of diacylated GAP-43 and H-Ras. Thus, the results demonstrate that APT-2/LYPLA2 is the protein thioesterase involved in the acylation/deacylation cycle operating in GAP-43 subcellular distribution.

References
  • Satou M, et al. (2010) Identification and characterization of acyl-protein thioesterase 1/lysophospholipase I as a ghrelin deacylation/lysophospholipid hydrolyzing enzyme in fetal bovine serum and conditioned medium. Endocrinology. 151(10): 4765-75.
  • Tomatis VM, et al. (2010) Acyl-protein thioesterase 2 catalyzes the deacylation of peripheral membrane-associated GAP-43. PLoS One. 5(11): e15045.
  • Size / Price
    Images
    • Human LYPLA2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"