Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FABP1cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Fatty acid-binding protein, liver, also known as Fatty acid-binding protein 1, Liver-type fatty acid-binding protein, FABP1 and FABPL,is a cytoplasm protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP1 and FABP6 (the ileal fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. FABP1 / FABPL binds free fatty acids and their coenzyme A derivatives, bilirubin, and some other small molecules in the cytoplasm. It forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. FABP1 / FABPL may be involved in intracellular lipid transport.

References
  • Chen SH, et al.,1986, Somat Cell Mol Genet 12 (3): 303-6.
  • Weickert MO, et al.,2007, Am J Physiol Endocrinol Metab. 293(4): E1078-84.
  • Noiri,E. et al., 2009, Am J Physiol Renal Physiol  296 (4):F669-79.
  • Fisher,E. et al., 2007, Mol Genet Metab. 91 (3):278-84. 
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"