After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human IFNL1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human IFNL1 Gene Plasmid Map
Human IFNL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Background

Interleukin-29(IL-29), also known as cytokine Zcyto21, Interferon lambda-1, IFN-lambda-1, and IFNL1, is a secreted protein which belongs to the IL-28 / IL-29 family. IL-29 is a cytokine with immunomodulatory activity. IL-29 is highly similar in amino acid sequence to the IL-28. IL-28 and IL-29 are induced by viral infection and showed antiviral activity. IL-28 and IL-29 interacted with a heterodimeric class II cytokine receptor that consisted of IL-10 receptor beta (IL-10Rbeta) and an orphan class II receptor chain, designated IL-28Ralpha. IL-29 plays an important role in host defenses against microbes and its gene is highly upregulated in cells infected with viruses. IL-29 may play a role in antiviral immunity. IL-29 up-regulates MHC class I antigen expression. It is a Ligand for the heterodimeric class II cytokine receptor composed of IL10RB and IL28RA. The ligand / receptor complex seems to signal through the Jak-STAT pathway.

References
  • Li MC, et al. (2006) Liposome-mediated IL-28 and IL-29 expression in A549 cells and anti-viral effect of IL-28 and IL-29 on WISH cells. Acta Pharmacol Sin. 27(4): 453-9.
  • Wang J, et al. (2009) Differentiated human alveolar type II cells secrete antiviral IL-29 (IFN-lambda 1) in response to influenza A infection. J Immunol. 182(3): 1296-304.
  • Jordan WJ, et al. (2007) Modulation of the human cytokine response by interferon lambda-1 (IFN-lambda1/IL-29). Genes Immun. 8(1): 13-20.
  • Images
    • Human IFNL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"