After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DAPK1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human DAPK1 Gene Plasmid Map
Human DAPK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Death-associated protein kinase 1, also known as DAP kinase 1, DAPK1 and DAPK, is a cytoplasm protein which belongs to the protein kinase superfamily, CAMK Ser / Thr protein kinase family and DAP kinase subfamily. DAPK1 contains ten ANK repeats, one death domain and one protein kinase domain. DAPK1 is a calcium / calmodulin-dependent serine/threonine kinase which acts as a positive regulator of apoptosis. DAPK1 gene is a candidate tumor suppressor (TSG) and the abnormal methylation of DAPK1 gene has been found in many carcinomas. DAPK1 over-expression can induce cell apoptosis and inhibit tumor cell metastasis. DAPK1 gene over-expression could suppress PGCl3 cells malignant phenotype, inhibit PGCl3 cells growth, invasive, migration and adhesion ability, upregulate p53 gene and downregulate bcl-2 gene. Loss of activity of death-associated protein kinase 1 ( DAPK1 ) may be an independent factor affecting survival of non-small cell lung cancer patients. DAPK1 promoter methylation might play a significant role in the progression of chronic myeloid leukemia ( CML ).

References
  • Zhang,H.T. et al., 2004, Ai Zheng. 23 (5):497-501.
  • Martoriati,A. et al., 2005, Oncogene. 24 (8):1461-6.
  • Li,Y. et al., 2006, Hum Mol Genet. 15 (17): 2560-8.
  • Martinez-Glez,V. et al., 2007, Neoplasma. 54 (2):123-6.
  • Raval,A. et al., 2007, Cell. 129 (5):879-90.
  • Gade,P. et al., 2009, Int J Cancer. 125 (7):1566-74.
  • Images
    • Human DAPK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"