Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD22cDNA Clone Product Information
cDNA Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is first expressed in the cytoplasm of pro-B and pre-B cells, and on the surface as B cells mature to become IgD+. CD22 serves as an adhesion receptor for sialic acid-bearing ligands expressed on erythrocytes and all leukocyte classes. In addition to its potential role as a mediator of intercellular interactions, signal transduction through CD22 can activate B cells and modulate antigen receptor signaling in vitro. The phenotype of CD22-deficient mice suggests that CD22 is primarily involved in the generation of mature B cells within the bone marrow, blood, and marginal zones of lymphoid tissues. CD22 recruits the tyrosine phosphatase Src homology 2 domain-containing phosphatase 1 (SHP-1) to immunoreceptor tyrosine-based inhibitory motifs (ITIMs) and inhibits B-cell receptor (BCR)-induced Ca2+ signaling on normal B cells. CD22 interacts specifically with ligands carrying alpha2-6-linked sialic acids. As an inhibitory coreceptor of the B-cell receptor (BCR), CD22 plays a critical role in establishing signalling thresholds for B-cell activation. Like other coreceptors, the ability of CD22 to modulate B-cell signalling is critically dependent upon its proximity to the BCR, and this in turn is governed by the binding of its extracellular domain to alpha2,6-linked sialic acid ligands. However, genetic studies in mice reveal that some CD22 functions are regulated by ligand binding, whereas other functions are ligand-independent and may only require expression of an intact CD22 cytoplasmic domain at the B-cell surface. CD19 regulates CD22 phosphorylation by augmenting Lyn kinase activity, while CD22 inhibits CD19 phosphorylation via SHP-1.

  • Tedder TF, et al. (1997) CD22, a B lymphocyte-specific adhesion molecule that regulates antigen receptor signaling. Annu Rev Immunol. 15: 481-504.
  • Tedder TF, et al. (2005) CD22: a multifunctional receptor that regulates B lymphocyte survival and signal transduction. Adv Immunol. 88: 1-50.
  • Fujimoto M, et al. (2007) B cell signaling and autoimmune diseases: CD19/CD22 loop as a B cell signaling device to regulate the balance of autoimmunity. J Dermatol Sci. 46(1): 1-9.
  • Walker JA, et al. (2008) CD22: an inhibitory enigma. Immunology. 123(3): 314-25.
  • Nitschke L. (2009) CD22 and Siglec-G: B-cell inhibitory receptors with distinct functions. Immunol Rev. 230(1): 128-43.
  • Size / Price
    • Human CD22 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items