Quick Order

Human ROCK2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ROCK2cDNA Clone Product Information
Gene_bank_ref_id:BC111801
cDNA Size:2112
cDNA Description:ORF Clone of Homo sapiens Rho-associated, coiled-coil containing protein kinase 2 DNA.
Gene Synonym:ROCK-II
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human ROCK2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name
Size / Price
Catalog:HG11956-G-N
List Price: $445.00  (Save $130.00)
Price:$315.00      [How to order]
Availability5 business days
Images
  • Human ROCK2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"