After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ANP32A cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human ANP32A Gene Plasmid Map
Human ANP32A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

acidic leucine-rich nuclear phosphoprotein 32 family member A, also known as acidic nuclear phosphoprotein pp32, Leucine-rich acidic nuclear protein, Mapmodulin, Potent heat-stable protein phosphatase 2A inhibitor I1PP2A, Putative HLA-DR-associated protein I, PHAPI and ANP32A, is a nucleus, cytoplasm and endoplasmic reticulum. ANP32A / LANP is expressed in all tissues tested. It is highly expressed in kidney and skeletal muscle, moderate levels of expression is in brain, placenta and pancreas. ANP32A / LANP is weakly expressed in lung. It is found in all regions of the brain examined (amygdala, caudate nucleus, corpus callosum, hippocampus and thalamus), with highest levels in amygdala. ANP32A / LANP is a component of the SET complex, which also contains SET, APEX1, HMGB2 and NME1. It directly interacts with SET. ANP32A / LANP also interacts with ATXN1/SCA1. ANP32A / LANP is implicated in a number of cellular processes, including proliferation, differentiation, caspase-dependent and caspase-independent apoptosis, suppression of transformation (tumor suppressor), inhibition of protein phosphatase 2A, regulation of mRNA trafficking and stability in association with ELAVL1, and inhibition of acetyltransferases as part of the INHAT (inhibitor of histone acetyltransferases) complex. ANP32A / LANP plays a role in E4F1-mediated transcriptional repression.

References
  • Bai J.et al., 2001, Oncogene. 20: 2153-60.
  • Brody J.R.et al.,1999, J. Biol. Chem. 274:20053-5.
  • Tsujio I.et al., 2005, FEBS Lett. 579: 363-72.
  • Molina H.et al., 2007,Proc. Natl. Acad. Sci. USA. 104: 2199-204.
  • Cvetanovic M. et al., 2007, EMBO Rep. 8:671-7.
  • Dephoure N.et al., 2008, Proc. Natl. Acad. Sci. USA. 105:10762-7.
  • Images
    • Human ANP32A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"