After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TREML1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human TREML1 Gene Plasmid Map
Human TREML1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Trem-like transcript 1 protein, also known as Triggering receptor expressed on myeloid cells-like protein 1, TREML1 and TLT-1, is a cytoplasm and single-pass type I  membrane protein. TREML1 / TLT-1 is expressed exclusively in platelets and megakaryocytes (MKs) and that its expression is up-regulated dramatically upon platelet activation. It is a receptor that may play a role in the innate and adaptive immune response. TREML1 / TLT-1 contains the characteristic single V-set immunoglobulin (Ig) domain, its longer cytoplasmic tail is composed of both a proline-rich region and an immune receptor tyrosine-based inhibitory motif, the latter known to be used for interactions with protein tyrosine phosphatases. The triggering receptors expressed on myeloid cells (TREMs) have drawn considerable attention due to their ability to activate multiple cell types within the innate immune system, including neutrophils, monocyte / macrophages, and dendritic cells, via their association with DAP12. TREML1 / TLT-1 is prepackaged, along with CD62P, into both MK and platelet alpha-granules. Differences in thrombin-induced redistribution of CD62P and TREML1 indicate that TREML1 is not simply cargo of alpha-granules but may instead regulate granule construction or dispersal. TREML1 / TLT-1 does not function to inhibit members of the TREM family but instead may play a role in maintaining vascular hemostasis and regulating coagulation and inflammation at sites of injury.

  • Washington A.V., et al., 2002, Blood 100:3822-4.
  • Allcock R.J.N., et al., 2003, Eur. J. Immunol. 33:567-77.
  • Washington A.V., et al., 2004, Blood 104:1042-7.
  • Barrow A.D., et al., 2004, J. Immunol. 172:5838-42.
  • Gattis J.L., et al., 2006,J. Biol. Chem. 281:13396-403.
  • Images
    • Human TREML1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items