Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CEACAM3 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human CEACAM3 Gene Plasmid Map
Human CEACAM3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

CeACAM3 (CD66d), a member of carcinoembryonic antigen family, is a granulocyte-specific receptor involved in the opsonin-independent recognition of several bacterial pathogens. There are four members in this family: CD66a, CD66b, CD66c, and CD66d. Members of CEACAM family are widely expressed especially on human neutrophils, and, depending on the tissue, capable of regulating diverse functions including tumor promotion, tumor suppression, angiogenesis, and neutrophil activation. Abnormal overexpression and downregulation of some CEACAMs have been described in tumor cells. Monoclonal antibodies grouped in the CD66 cluster recognize CEACAM members. Ectopic CD66 expression is commonly detected in B-cell lineage acute lymphoblastic leukemia (ALL). CEACAM3 mediates phagocytosis depends on the integrity of an ITAM-like sequence within the cytoplasmic domain of CEACAM3. CEACAM3 is characterized by rapid stimulation of the GTPase Rac.

  • Schmitter T, et al. (2007) The Granulocyte Receptor Carcinoembryonic Antigen-Related Cell Adhesion Molecule 3 (CEACAM3) Directly Associates with Vav to Promote Phagocytosis of Human Pathogens. The journal of immunology. 178: 3797-805.
  • Swanson KV, et al. (2001) CEACAM is not necessary for Neisseria gonorrhoeae to adhere to and invade female genital epithelial cells. Cellular Microbiology. 3 (10): 681-91.
  • Hasselbalch HC, et al. (2011) High expression of carcinoembryonic antigen-related cell adhesion molecule (CEACAM) 6 and 8 in primary myelofibrosis. Leukemia Research.
  • Images
    • Human CEACAM3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items