After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TPH1cDNA Clone Product Information
cDNA Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Tryptophan 5-hydroxylase 1, also known as Tryptophan 5-monooxygenase 1, Tryptophan hydroxylase 1, TPH1, TPH and TPRH, is an enzyme which belongs to the biopterin-dependent aromatic amino acid hydroxylase family. TPH1 contains one ACT domain. Tryptophan hydroxylase catalyzes the biopterin-dependent monooxygenation of tryptophan to 5-hydroxytryptophan (5HT), which is subsequently decarboxylated to form the neurotransmitter serotonin. It is the rate-limiting enzyme in the biosynthesis of serotonin. It is the rate-limiting enzyme in the biosynthesis of serotonin. TPH1 expression is limited to a few specialized tissues: raphe neurons, pinealocytes, mast cells, mononuclear leukocytes, beta-cells of the islets of Langerhans, and intestinal and pancreatic enterochromaffin cells.The tryptophan hydroxylase 1 (TPH1) gene is also reported to be associated with suicidal behavior. Polymorphisms of TPH1 may assist in identifying a subgroup of mood disorder patients that is at higher risk for suicidal behavior.

  • Antonia S. New, et al.,1998, American Journal of Medical Genetics Part B. 81 (1): 13-17.
  • Y. C Wang, et al.,2001, Neuropsychobiology. 43 (1): 1 - 4.
  • Diego J. et al., 2003, Science. 299 (5603): 76.
  • Allen NC, et al.,2008, Nat Genet. 40 (7): 827-34.
  • Galfalvy,H. et al., 2009, J Affect Disord. 115 (3):331-8.
  • Size / Price
    • Human TPH1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items