Quick Order

Human DMP1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DMP1 cDNA Clone Product Information
Gene_bank_ref_id:BC130581
RefSeq ORF Size:1542bp
cDNA Description:Full length Clone DNA of Homo sapiens dentin matrix acidic phosphoprotein 1.
Gene Synonym:ARHP, ARHR, DMP-1
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-DMP1
Restriction Site:HindIII + XhoI (5.5kb + 1.54kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human DMP1 Gene Plasmid Map
Human DMP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human DMP1 natural ORF mammalian expression plasmid on other vectors
Product nameProduct name
Background

Dentin matrix acidic phosphoprotein (DMP1) is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. DMP1 contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation, DMP1 becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in DMP1 are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. DMP1 may have a dual function during osteoblast differentiation. In the nucleus of undifferentiated osteoblasts, unphosphorylated form acts as a transcriptional component for activation of osteoblast-specific genes like osteocalcin. During the osteoblast to osteocyte transition phase it is phosphorylated and exported into the extracellular matrix, where it regulates nucleation of hydroxyapatite.

References
  • Aplin HM, et al. (1996) Mapping of the human dentin matrix acidic phosphoprotein gene (DMP1) to the dentinogenesis imperfecta type II critical region at chromosome 4q21. Genomics. 30 (2): 347-9.
  • Hirst KL, et al. (1997) Elucidation of the sequence and the genomic organization of the human dentin matrix acidic phosphoprotein 1 (DMP1) gene: exclusion of the locus from a causative role in the pathogenesis of dentinogenesis imperfecta type II. Genomics. 42 (1): 38-45.
  • Chen S, et al. (2005) Binding of two nuclear factors to a novel silencer element in human dentin matrix protein 1 (DMP1) promoter regulates the cell type-specific DMP1 gene expression. J Cell Biochem. 92 (2): 332-49.
  • Size / Price
    Catalog: HG11929-G-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"