Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CPLX2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Complexin-2 (CPLX2), a member of the complexin/synaphin family, is a soluble pre-synaptic protein believed to regulate neurotransmitter release from pre-synaptic terminals. Complexins are soluble proteins that regulate the activity of soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complexes necessary for vesicle fusion. Complexins are unable to bind to monomeric SNARE proteins but bind with high affinity to ternary SNARE complexes and with lower affinity to target SNARE complexes. Complexin 1 (CX1) and complexin 2 (CX2) are presynaptic proteins that modulate neurotransmitter release and are used as markers of inhibitory and excitatory synapses, respectively. CPLX2 is localized in pre-synaptic terminals in mature brain. The G71-P89 region of CPLX2 is essential and sufficient for preferential axonal distribution. CPLX2 participates in the Ca(2+)-sensitive regulatory pathway for zymogen granule exocytosis. Complexin-2 is a key player in normal neurological function, and its downregulation could lead to changes in neurotransmitter release sufficient to cause significant behavioural abnormalities such as depression. It is involved in synaptogenesis and the modulation of neurotransmitter release.

  • Lee HJ, et al. (2005) Association study of polymorphisms in synaptic vesicle-associated genes, SYN2 and CPLX2, with schizophrenia. Behav Brain Funct. 1: 15.
  • Salimi K, et al. (2008) Regulation of complexin 1 and complexin 2 in the developing human prefrontal cortex. Synapse. 62(4): 273-82.
  • Kataoka M, et al. (2009) Identification of a minimal segment of complexin II essential for preferential distribution in axons. J Neurochem. 108(5): 1109-15.
  • Glynn D, et al. (2010) Clorgyline-mediated reversal of neurological deficits in a Complexin 2 knockout mouse. Hum Mol Genet. 19(17): 3402-12.
  • Falkowski MA, et al. (2010) Complexin 2 modulates vesicle-associated membrane protein (VAMP) 2-regulated zymogen granule exocytosis in pancreatic acini. J Biol Chem. 285(46): 35558-66.
  • Images
    • Human CPLX2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items