After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TGM3 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Transglutaminases (TGase) are a family of calcium-dependent acyl-transfer enzymes ubiquitously expressed in mammalian cells and responsible for catalyzing covalent cross-links between proteins or peptides. Transglutaminase 3 (TGM3) is a member of a family of Ca2+-dependent enzymes that catalyze covalent cross-linking reactions between proteins or peptides. TGM3 isoform is widely expressed and is important for epithelial barrier formation. It is a zymogen, requiring proteolysis for activity. Calcium-activated TGM3 can bind, hydrolyze, and is inhibited by GTP, despite lacking structural homology with other GTP binding proteins. TGM3 displays a diffuse cytoplasmic distribution in vitro consistent with its proposed role in the early phase of cornified cell envelope assembly in the cytoplasm. TGM3-driven specific isopeptide bonds between intermediate filaments and KAPs participate to the progressive scaffolding of the hair shaft. Additionally, TGM3 may be a novel prognostic biomarker for esophageal squamous cell carcinoma (ESCC).

  • Ahvazi B, et al. (2002) Three-dimensional structure of the human transglutaminase 3 enzyme: binding of calcium ions changes structure for activation. EMBO J. 21(9): 2055-67.
  • Hitomi K, et al. (2003) Analysis of epidermal-type transglutaminase (transglutaminase 3) in human stratified epithelia and cultured keratinocytes using monoclonal antibodies. J Dermatol Sci. 32(2): 95-103.
  • Ahvazi B, et al. (2004) The emerging structural understanding of transglutaminase 3. J Struct Biol. 147(2): 200-7.
  • Ahvazi B, et al. (2004) Structural basis for the coordinated regulation of transglutaminase 3 by guanine nucleotides and calcium/magnesium. J Biol Chem. 279(8): 7180-92.
  • Uemura N, et al. (2009) Transglutaminase 3 as a prognostic biomarker in esophageal cancer revealed by proteomics. Int J Cancer. 124(9): 2106-15.
  • Thibaut S, et al. (2009) Transglutaminase-3 enzyme: a putative actor in human hair shaft scaffolding? J Invest Dermatol. 129(2): 449-59.
  • Images
    • Human TGM3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items